|
Sangon Biotech
n000013 recombinant dna plko 1 shcherp sangon biotech n a plko 1 nc sangon biotech n a software N000013 Recombinant Dna Plko 1 Shcherp Sangon Biotech N A Plko 1 Nc Sangon Biotech N A Software, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/1+1+a+a+biotech+biotech+dna+n+n+n000013+nc+plko+plko+recombinant+sangon+sangon+shcherp+software/10__1016_slash_j__isci__2026__116257-451-0-4 Average 86 stars, based on 1 article reviews
n000013 recombinant dna plko 1 shcherp sangon biotech n a plko 1 nc sangon biotech n a software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
OriGene
paper n a pcmv6 ac rfp origene ps100034 software Paper N A Pcmv6 Ac Rfp Origene Ps100034 Software, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/pCMV6-AC-RFP+Mammalian+Expression+Vector/pm42228570-355-74-77 Average 94 stars, based on 1 article reviews
paper n a pcmv6 ac rfp origene ps100034 software - by Bioz Stars,
2026-09
94/100 stars
|
Buy from Supplier |
|
Twist Bioscience
recombinant dna hdr dna template sequence twist bioscience n a software Recombinant Dna Hdr Dna Template Sequence Twist Bioscience N A Software, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/dna+repair+template/10__1016_slash_j__isci__2026__116175-216-100-106 Average 86 stars, based on 1 article reviews
recombinant dna hdr dna template sequence twist bioscience n a software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Tree Star Inc
mtagbfp2 ovaag85b gblocks integrated dna technologies inc n a software Mtagbfp2 Ovaag85b Gblocks Integrated Dna Technologies Inc N A Software, supplied by Tree Star Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/7+a+a+dna+dna+dna+exon+integrated+integrated+n+n+recombinant+software+ssdna+technologies+technologies+tnfrsf14/pm42217183-414-160-180 Average 86 stars, based on 1 article reviews
mtagbfp2 ovaag85b gblocks integrated dna technologies inc n a software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Genechem
zsgreen hanbio technology n a ckap4 oe lentivirus genechem n a lentiviral negative control genechem n a software Zsgreen Hanbio Technology N A Ckap4 Oe Lentivirus Genechem N A Lentiviral Negative Control Genechem N A Software, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/control+negative/pm42207635-298-55-61 Average 86 stars, based on 1 article reviews
zsgreen hanbio technology n a ckap4 oe lentivirus genechem n a lentiviral negative control genechem n a software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
JASCO Inc
kết quả ph n tích được xử lý bằng phần mềm chromnav 2 0 hplc software Kết Quả Ph N Tích được Xử Lý Bằng Phần Mềm Chromnav 2 0 Hplc Software, supplied by JASCO Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/JASCO+HPLC/10__25073_slash_2588___1132_slash_vnumps__4887-72-0-14 Average 99 stars, based on 1 article reviews
kết quả ph n tích được xử lý bằng phần mềm chromnav 2 0 hplc software - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Eurofins
mr1fl fl deletion tgcccaagaagtggattacgg eurofins n a software Mr1fl Fl Deletion Tgcccaagaagtggattacgg Eurofins N A Software, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/a+deletion+eurofins+fl+gtttcttcttcagtcacaca+mr1fl+n+primer+rev/pm42025176-582-33-36 Average 86 stars, based on 1 article reviews
mr1fl fl deletion tgcccaagaagtggattacgg eurofins n a software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Partek
krashes lab n a oligonucleotides recombinant dna software Krashes Lab N A Oligonucleotides Recombinant Dna Software, supplied by Partek, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/a+dna+krashes+lab+n+oligonucleotides+recombinant+software/pm42025694-848-58-76 Average 86 stars, based on 1 article reviews
krashes lab n a oligonucleotides recombinant dna software - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Gataca Inc
algorithms gen5 software biotek n a metamorph 7 8 13 gataca systems n a fiji nih Algorithms Gen5 Software Biotek N A Metamorph 7 8 13 Gataca Systems N A Fiji Nih, supplied by Gataca Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/13+7+8+a+a+algorithms+biotek+fiji+gataca+gen5+metamorph+n+n+nih+software+systems/pm41996234-680-156-163 Average 86 stars, based on 1 article reviews
algorithms gen5 software biotek n a metamorph 7 8 13 gataca systems n a fiji nih - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
ATCC
crl 3216 tzm b1 cells nih aids reagents program n a software Crl 3216 Tzm B1 Cells Nih Aids Reagents Program N A Software, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/n+a+software/293T/pm41985438-895-65-63 Average 99 stars, based on 1 article reviews
crl 3216 tzm b1 cells nih aids reagents program n a software - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |